Stem-loop sequence bdi-MIR5058

AccessionMI0017948 (change log)
DescriptionBrachypodium distachyon miR5058 stem-loop
Stem-loop
   guccaauuuaaa       --    u    aac           caa   g 
5'             caguuga  ggga gaaa   aaaaaaaaaau   guu a
               |||||||  |||| ||||   |||||||||||   |||  
3'             guuaauu  uccu cuuu   uuuuuuuuuua   cag g
   uguuuauaagua       ga    -    cca           ---   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 31543610-31543707 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR5058
bdi-MIR7708a4: 31535894-31536302 [+]
bdi-MIR50584: 31543610-31543707 [+]
Database links

Mature sequence bdi-miR5058

Accession MIMAT0020557
Sequence

11 - 

aacaguugagggaugaaaaaca

 - 32

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).