Stem-loop sequence bdi-MIR5057

AccessionMI0017947 (change log)
DescriptionBrachypodium distachyon miR5057 stem-loop
Stem-loop
   uggc    ---cca      c       ---     ca   u 
5'     acag      aaauuu aaaucau   uuuga  aag u
       ||||      |||||| |||||||   |||||  |||  
3'     uguc      uuuaaa uuuggua   aaacu  uuc a
   ---a    aaaaag      -       cuu     cg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 10594352-10594427 [+]
intergenic
Database links

Mature sequence bdi-miR5057

Accession MIMAT0020556
Sequence

12 - 

aaauuucaaaucauuuugaca

 - 32

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).