Stem-loop sequence bdi-MIR5056

AccessionMI0017945 (change log)
DescriptionBrachypodium distachyon miR5056 stem-loop
Stem-loop
   cucaauu        -    -cc   -      c    aaccauccauucagguucuacauuuguuugaauaa 
5'        ugggagga agaa   ggu aauaag aaaa                                   a
          |||||||| ||||   ||| |||||| ||||                                    
3'        acccuucu ucuu   cua uuauuc uuuu                                   a
   ucuacuu        a    uuu   c      -    caaaaaaacuaaucugcguacguuaaccgcuuugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 20794717-20794860 [+]
intergenic
Database links

Mature sequence bdi-miR5056

Accession MIMAT0020554
Sequence

12 - 

aggaagaaccgguaauaagca

 - 32

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).