Stem-loop sequence hvu-MIR5053

AccessionMI0017940 (change log)
DescriptionHordeum vulgare miR5053 stem-loop
Literature search

1 open access papers mention hvu-MIR5053
(3 sentences)

Stem-loop
   ----  ccaccu     c  uaguuc       -     uugcucgagcucuccccgu 
5'     gc      cgccg cg      caguugc ugcug                   a
       ||      ||||| ||      ||||||| |||||                   g
3'     cg      gcggc gc      gucgacg acgac                   c
   cuaa  -uuccu     c  --ugau       c     cugcacagccucuuggacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR5053

Accession MIMAT0020549
Sequence

81 - 

cgcagcuguagucgccggcgu

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).