Stem-loop sequence hvu-MIR5052

AccessionMI0017939 (change log)
DescriptionHordeum vulgare miR5052 stem-loop
Literature search

1 open access papers mention hvu-MIR5052
(2 sentences)

Stem-loop
          aua   g   --  a                    c   ca  ag    aa u      c   gaucaa g  ga   uu  u 
5' uucuacc   acc gcu  gg cgguaggcauacacauccua cgc  ca  cagu  c guaggg ucg      u cg  ugg  cc u
   |||||||   ||| |||  || |||||||||||||||||||| |||  ||  ||||  | |||||| |||      | ||  |||  ||  
3' aggaugg   ugg cga  cc gccauccguauguguaggau gcg  gu  guua  g uauucc agc      a gc  acu  gg c
          cag   g   ua  -                    a   ac  cu    cc c      -   aaacug g  -a   --  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR5052

Accession MIMAT0020548
Sequence

11 - 

accggcuggacgguaggcaua

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).