Stem-loop sequence hvu-MIR5051

AccessionMI0017938 (change log)
DescriptionHordeum vulgare miR5051 stem-loop
Literature search

2 open access papers mention hvu-MIR5051
(2 sentences)

Stem-loop
   gc  g  cu                u               u     -  au 
5'   ag ua  guuccaguuucaaggu ucaaagcugaaggcu cccag ag  c
     || ||  |||||||||||||||| ||||||||||||||| ||||| ||   
3'   uc au  cagggucaaaguucca gguuucgauuucugg ggguc uc  c
   uu  g  uu                c               u     g  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR5051

Accession MIMAT0020547
Sequence

75 - 

uuuggcaccuugaaacuggga

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).