Stem-loop sequence hvu-MIR5050

AccessionMI0017937 (change log)
DescriptionHordeum vulgare miR5050 stem-loop
Gene family MIPF0002014; MIR5050
Literature search

1 open access papers mention hvu-MIR5050
(2 sentences)

Stem-loop
       g      u  c               c    ucgaccgccucuuccuugacaggu 
5' gcug uguuuu gc gguugaacgaccuca caug                        a
   |||| |||||| || ||||||||||||||| ||||                         
3' cggc gcaaaa cg ccaacuugcuggagu guac                        u
       g      -  a               u    cgugcucgucuagaaaagaaggac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR5050

Accession MIMAT0020546
Sequence

90 - 

uugaggucguucaaccagcaa

 - 110

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).