Stem-loop sequence hvu-MIR5048a

AccessionMI0017935 (change log)
Previous IDshvu-MIR5048
DescriptionHordeum vulgare miR5048 stem-loop
Gene family MIPF0001453; MIR5048
Literature search

5 open access papers mention hvu-MIR5048a
(27 sentences)

Stem-loop
   u    c            ggu             ggug    u   u    ---   u   u   u      c       u   -        uu        cuuucaugagaaaugauugucccacaugcauauccaugacuaaaaaaagcaaaaaaguaauaauuggguguuguguucu 
5'  cuag aauauauuugca   uuuaggucuaagu    aaua cga cucu   gaa aua uga aaccuu acaaauu gcu gauuauuu  guagcgcu                                                                               c
    |||| ||||||||||||   |||||||||||||    |||| ||| ||||   ||| ||| ||| |||||| ||||||| ||| ||||||||  ||||||||                                                                                
3'  gauc uuauaugaacgu   agauccagauuua    uuau guu gaga   cuu uau auu uuggaa uguuuaa uga cuaguaag  uaucguga                                                                               a
   g    u            -ac             auug    -   -    acg   c   u   u      -       -   a        -u        aauaguaauaccuaaguacguauuaguuucguaaguagaaggaaguguucaaaaacaauuugaaaagguagaaagaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR5048a

Accession MIMAT0020544
Previous IDshvu-miR5048
Sequence

11 - 

uauuugcagguuuuaggucuaa

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).