![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4787 |
|||||
Accession | MI0017434 (change log) | ||||
Symbol | HGNC:MIR4787 | ||||
Description | Homo sapiens miR-4787 stem-loop | ||||
Literature search |
3 open access papers mention hsa-mir-4787 | ||||
Stem-loop |
c ac - ---- g gg g 5' cgguc ag guggcg ggggu ggcggcg cauccc ac g ||||| || |||||| ||||| ||||||| |||||| || c 3' gccag uc cgccgc ccccg ccgccgc guaggg ug c - -- g ucac - ag u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4787-5p |
|
Accession | MIMAT0019956 |
Sequence |
14 - gcggggguggcggcggcauccc - 35 |
Deep sequencing | 261 reads, 72 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-4787-3p |
|
Accession | MIMAT0019957 |
Sequence |
51 - gaugcgccgcccacugccccgcgc - 74 |
Deep sequencing | 1406 reads, 92 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
2 |
PMID:21558790
"Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis"
RNA Biol. 8:378-383(2011).
|