Stem-loop sequence hsa-mir-4787

AccessionMI0017434 (change log)
Symbol HGNC:MIR4787
DescriptionHomo sapiens miR-4787 stem-loop
Literature search

3 open access papers mention hsa-mir-4787
(3 sentences)

Stem-loop
        c  ac      -     ----       g      gg  g 
5' cgguc ag  guggcg ggggu    ggcggcg cauccc  ac g
   ||||| ||  |||||| |||||    ||||||| ||||||  || c
3' gccag uc  cgccgc ccccg    ccgccgc guaggg  ug c
        -  --      g     ucac       -      ag  u 
Get sequence
Deep sequencing
1669 reads, 4.46 reads per million, 112 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 50675080-50675163 [+]
sense
OTTHUMT00000346241 ; MAPKAPK3-006; intron 1
OTTHUMT00000346240 ; MAPKAPK3-005; intron 2
OTTHUMT00000346236 ; MAPKAPK3-001; intron 2
OTTHUMT00000346237 ; MAPKAPK3-002; intron 4
ENST00000457064 ; MAPKAPK3-006; intron 1
ENST00000430409 ; MAPKAPK3-005; intron 2
ENST00000357955 ; MAPKAPK3-001; intron 2
ENST00000446044 ; MAPKAPK3-002; intron 4
Database links

Mature sequence hsa-miR-4787-5p

Accession MIMAT0019956
Sequence

14 - 

gcggggguggcggcggcauccc

 - 35

Get sequence
Deep sequencing261 reads, 72 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4787-3p

Accession MIMAT0019957
Sequence

51 - 

gaugcgccgcccacugccccgcgc

 - 74

Get sequence
Deep sequencing1406 reads, 92 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).