Stem-loop sequence hsa-mir-4739

Accession

MI0017377 (change log)

Symbol

HGNC:MIR4739

Description

Homo sapiens miR-4739 stem-loop

Literature search

7 open access papers mention hsa-mir-4739
(10 sentences)

Stem-loop

         aa  a         agc        c  u u 
5' gggagg  ga gggaggagg   ggaggggc cu g c
   ||||||  || |||||||||   |||||||| || | u
3' cccucc  cu cccuccuuc   ccucuccg ga c u
         cc  c         ---        a  c c 

Deep sequencing

343 reads, 167 reads per million, 90 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr17: 79707176-79707249 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR4739
• HGNC:MIR4739
• RNAcentral:URS0000759B47_9606
• miRBase Tracker:MI0017377

Mature sequence hsa-miR-4739

• Accession: MIMAT0019868
• Sequence: 10 - aagggaggaggagcggaggggcccu - 34
• Deep sequencing: 75 reads, 40 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS00002578DA_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4739
  • TargetScanVert:hsa-miR-4739
  • miRDB:hsa-miR-4739

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).