![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3064 |
||||||
Accession | MI0017375 (change log) | |||||
Symbol | HGNC:MIR3064 | |||||
Description | Homo sapiens miR-3064 stem-loop | |||||
Gene family | MIPF0001238; mir-3064 | |||||
Literature search |
![]()
7 open access papers mention hsa-mir-3064 | |||||
Stem-loop |
-g cu c ug - cuc u 5' gu gg uguug gugug caaaa cg a || || ||||| ||||| ||||| || c 3' ca cc acaac cacac guuuu gu a ga uu - gu c auc u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence hsa-miR-3064-5p |
|
Accession | MIMAT0019864 |
Sequence |
3 - ucuggcuguuguggugugcaa - 23 |
Deep sequencing | 462 reads, 99 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-3064-3p |
|
Accession | MIMAT0019865 |
Sequence |
43 - uugccacacugcaacaccuuaca - 65 |
Deep sequencing | 175 reads, 72 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|