![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4687 |
|||||
Accession | MI0017319 (change log) | ||||
Symbol | HGNC:MIR4687 | ||||
Description | Homo sapiens miR-4687 stem-loop | ||||
Literature search |
3 open access papers mention hsa-mir-4687 | ||||
Stem-loop |
ag a u c c cu g g 5' accug gagcc gccc ccucc gca ccaaa u ga c ||||| ||||| |||| ||||| ||| ||||| | || 3' ugggc cucgg cggg ggagg ugu gguuu a uu a -g a - u c cc g c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4687-5p |
|
Accession | MIMAT0019774 |
Sequence |
12 - cagcccuccucccgcacccaaa - 33 |
Deep sequencing | 70 reads, 46 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4687-3p |
|
Accession | MIMAT0019775 |
Sequence |
52 - uggcuguuggagggggcaggc - 72 |
Deep sequencing | 89 reads, 47 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|