Stem-loop sequence hsa-mir-4660

Accession

MI0017288 (change log)

Symbol

HGNC:MIR4660

Description

Homo sapiens miR-4660 stem-loop

Gene family

MIPF0001460; mir-4660

Stem-loop

        u  ugca       u   aa      --   ac 
5' acucc uc    gcucugg gga  auggag  aag  u
   ||||| ||    ||||||| |||  ||||||  |||  u
3' ugagg gg    cgggacc ccu  uaccuc  uuc  u
        u  --uc       c   -c      cu   cu 

Deep sequencing

202 reads, 22.5 reads per million, 71 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr8: 9048445-9048518 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000374699 ; RP11-10A14.5-003; intron 1

  OTTHUMT00000374700 ; RP11-10A14.5-002; intron 1

  OTTHUMT00000374698 ; RP11-10A14.5-001; intron 2

  ENST00000417333 ; RP11-10A14.5-003; intron 1

  ENST00000523747 ; RP11-10A14.5-002; intron 1

  ENST00000512942 ; RP11-10A14.5-001; intron 2

Database links

• EntrezGene:MIR4660
• HGNC:MIR4660
• miRBase Tracker:MI0017288

Mature sequence hsa-miR-4660

• Accession: MIMAT0019728
• Sequence: 9 - ugcagcucugguggaaaauggag - 31
• Deep sequencing: 164 reads, 45 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetMiner:hsa-miR-4660
  • TargetScanVert:hsa-miR-4660
  • miRDB:hsa-miR-4660

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).