![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4660 |
|||||
Accession | MI0017288 (change log) | ||||
Symbol | HGNC:MIR4660 | ||||
Description | Homo sapiens miR-4660 stem-loop | ||||
Gene family | MIPF0001460; mir-4660 | ||||
Stem-loop |
u ugca u aa -- ac 5' acucc uc gcucugg gga auggag aag u ||||| || ||||||| ||| |||||| ||| u 3' ugagg gg cgggacc ccu uaccuc uuc u u --uc c -c cu cu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4660 |
|
Accession | MIMAT0019728 |
Sequence |
9 - ugcagcucugguggaaaauggag - 31 |
Deep sequencing | 164 reads, 45 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|