![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4641 |
|||||
Accession | MI0017268 (change log) | ||||
Symbol | HGNC:MIR4641 | ||||
Description | Homo sapiens miR-4641 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-4641 | ||||
Stem-loop |
gg -- --g ga -a a 5' ggggca gg ggca gggcaucag gg c |||||| || |||| ||||||||| || 3' cuccgu uc ccgu cccgugguc cc a ga uu aua -a cg g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4641 |
|
Accession | MIMAT0019701 |
Sequence |
42 - ugcccaugccauacuuuugccuca - 65 |
Deep sequencing | 45 reads, 25 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|