Stem-loop sequence hsa-mir-4635

AccessionMI0017262 (change log)
Symbol HGNC:MIR4635
DescriptionHomo sapiens miR-4635 stem-loop
Literature search

2 open access papers mention hsa-mir-4635
(3 sentences)

Stem-loop 
                         cc  cuu      cgccg 
5' ccgggacuuuguggguucugac  ca   ggauca     a
   ||||||||||||||||||||||  ||   ||||||      
3' gguccugaaacgcccaagacug  gu   ucuggu     c
                         aa  ---      cacaa
Get sequence
Deep sequencing
899 reads, 2.82 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 1062896-1062974 [-]
sense
OTTHUMT00000366451 ; SLC12A7-008; intron 1
OTTHUMT00000366450 ; SLC12A7-007; intron 5
OTTHUMT00000366446 ; SLC12A7-001; intron 20
ENST00000514994 ; SLC12A7-008; intron 1
ENST00000513223 ; SLC12A7-007; intron 5
ENST00000264930 ; SLC12A7-001; intron 20
Database links

Mature sequence hsa-miR-4635

Accession MIMAT0019692
Sequence

51 -  

ucuugaagucagaacccgcaa

 - 71

Get sequence
Deep sequencing896 reads, 71 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).