Stem-loop sequence pma-mir-203a

AccessionMI0017104 (change log)
DescriptionPetromyzon marinus miR-203a stem-loop
Gene family MIPF0000108; mir-203
Stem-loop
   ucu     -    g            cau  g    a     -  u 
5'    gcuuc ccgg cccagugguucu   ca uuca caguu cu u
      ||||| |||| ||||||||||||   || |||| ||||| ||  
3'    cgggg ggcc gggucaccagga   gu aagu guuaa ga g
   cuc     a    a            uuu  a    -     a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-203a-5p

Accession MIMAT0019511
Previous IDspma-miR-203a*
Sequence

17 - 

agugguucucaucaguucaaca

 - 38

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-203a-3p

Accession MIMAT0019512
Previous IDspma-miR-203a
Sequence

55 - 

gugaaauguuuaggaccacugg

 - 76

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).