![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence pma-mir-203a |
|
Accession | MI0017104 (change log) |
Description | Petromyzon marinus miR-203a stem-loop |
Gene family | MIPF0000108; mir-203 |
Stem-loop |
ucu - g cau g a - u 5' gcuuc ccgg cccagugguucu ca uuca caguu cu u ||||| |||| |||||||||||| || |||| ||||| || 3' cgggg ggcc gggucaccagga gu aagu guuaa ga g cuc a a uuu a - a g |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence pma-miR-203a-5p |
|
Accession | MIMAT0019511 |
Previous IDs | pma-miR-203a* |
Sequence |
17 - agugguucucaucaguucaaca - 38 |
Evidence | experimental; 454 [1] |
Mature sequence pma-miR-203a-3p |
|
Accession | MIMAT0019512 |
Previous IDs | pma-miR-203a |
Sequence |
55 - gugaaauguuuaggaccacugg - 76 |
Evidence | experimental; 454 [1] |
References |
|
1 |
PMID:20959416
"microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate"
Proc Natl Acad Sci U S A. 107:19379-19383(2010).
|