![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4521 |
|||||
Accession | MI0016887 (change log) | ||||
Symbol | HGNC:MIR4521 | ||||
Description | Homo sapiens miR-4521 stem-loop | ||||
Literature search |
3 open access papers mention hsa-mir-4521 | ||||
Stem-loop |
uc u - gugcuc ua 5' ggc aag gaaguccu aguuuug g ||| ||| |||||||| ||||||| 3' uug uuc cuuuagga ucaaaac c ca - u ------ ua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4521 |
|
Accession | MIMAT0019058 |
Sequence |
4 - gcuaaggaaguccugugcucag - 25 |
Deep sequencing | 240453 reads, 132 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|