![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4515 |
|||||
Accession | MI0016881 (change log) | ||||
Symbol | HGNC:MIR4515 | ||||
Description | Homo sapiens miR-4515 stem-loop | ||||
Gene family | MIPF0001512; mir-4515 | ||||
Literature search |
1 open access papers mention hsa-mir-4515 | ||||
Stem-loop |
-g - -guaac ug a g a ag 5' cgggag gu aggac g cuccc gc gcccc g |||||| || ||||| | ||||| || ||||| 3' gcccuc cg uccug c gaggg ug cgggg g ag g acucga gu - g - ac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4515 |
|
Accession | MIMAT0019052 |
Sequence |
15 - aggacuggacucccggcagccc - 36 |
Deep sequencing | 112 reads, 33 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|