![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4512 |
|||||
Accession | MI0016878 (change log) | ||||
Symbol | HGNC:MIR4512 | ||||
Description | Homo sapiens miR-4512 stem-loop | ||||
Literature search |
2 open access papers mention hsa-mir-4512 | ||||
Stem-loop |
c c a a uc uaca 5' ucagcc gggc auauagugag cc gucuc a |||||| |||| |||||||||| || ||||| a 3' ggucgg cccg uaugucacuc gg cagag a a a c c ga uuaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-4512 |
|
Accession | MIMAT0019049 |
Sequence |
49 - cagggccucacuguaucgccca - 70 |
Deep sequencing | 182 reads, 56 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|