![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3689d-2 |
||||||||||||||||
Accession | MI0016835 (change log) | |||||||||||||||
Symbol | HGNC:MIR3689D2 | |||||||||||||||
Description | Homo sapiens miR-3689d-2 stem-loop | |||||||||||||||
Gene family | MIPF0001144; mir-3689 | |||||||||||||||
Stem-loop |
--acu ---u u u a g u - ug 5' gggagg g gauc cac cuc c gggagg ug c |||||| | |||| ||| ||| | |||||| || 3' uccuuc c cuag gug gag g cccuuc gc u gcgag uugu - u - g u u ua |
|||||||||||||||
Deep sequencing |
| |||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
Mature sequence hsa-miR-3689d |
|
Accession | MIMAT0019008 |
Sequence |
4 - gggaggugugaucucacacucg - 25 |
Deep sequencing | 5 reads, 5 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|