![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3689c |
||||||||||||||||
Accession | MI0016832 (change log) | |||||||||||||||
Symbol | HGNC:MIR3689C | |||||||||||||||
Description | Homo sapiens miR-3689c stem-loop | |||||||||||||||
Gene family | MIPF0001144; mir-3689 | |||||||||||||||
Literature search |
2 open access papers mention hsa-mir-3689c | |||||||||||||||
Stem-loop |
g ug gu g ug g gu a 5' gggag ug auauc g uucc ggag u g u ||||| || ||||| | |||| |||| | | 3' uccuu gu uauag u gagg ccuu g c a g gu ug g gu g ug u |
|||||||||||||||
Deep sequencing |
| |||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
Mature sequence hsa-miR-3689c |
|
Accession | MIMAT0019007 |
Sequence |
47 - cugggaggugugauauuguggu - 68 |
Deep sequencing | 1 reads, 1 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|