![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4475 |
|||||
Accession | MI0016827 (change log) | ||||
Symbol | HGNC:MIR4475 | ||||
Description | Homo sapiens miR-4475 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-4475 | ||||
Stem-loop |
a uc g aaa u 5' uc aaugagugu ugguucu ugac c || ||||||||| ||||||| |||| a 3' ag uuacuuacg accaggg acug u a ua a --a a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4475 |
|
Accession | MIMAT0019002 |
Sequence |
37 - caagggaccaagcauucauuau - 58 |
Deep sequencing | 25 reads, 12 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|