![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4460 |
|||||
Accession | MI0016806 (change log) | ||||
Symbol | HGNC:MIR4460 | ||||
Description | Homo sapiens miR-4460 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-4460 | ||||
Stem-loop |
gu -cc uuu
5' uuuuugcccauagugguugugaauuuaccuucu uc g
||||||||||||||||||||||||||||||||| ||
3' aaagacgggugucaccaacacuuaaauggagga ag c
-c aau uga
|
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4460 |
|
Accession | MIMAT0018982 |
Sequence |
12 - auagugguugugaauuuaccuu - 33 |
Deep sequencing | 12 reads, 7 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|