Stem-loop sequence csi-MIR167a

AccessionMI0016740 (change log)
DescriptionCitrus sinensis miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

6 open access papers mention csi-MIR167a
(8 sentences)

Stem-loop
     -    g      u            c        aa        -  ccu 
5' gc acua uaguag ugaagcugccag augaucug  cuuuccuu ga   c
   || |||| |||||| |||||||||||| ||||||||  |||||||| ||    
3' cg uggu guuauc acuuugacgguc uacuagac  gaaaggga cu   c
     a    a      c            -        cg        u  cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr3: 14951537-14951639 [+]
intergenic
Database links

Mature sequence csi-miR167a-5p

Accession MIMAT0018498
Sequence

15 - 

ugaagcugccagcaugaucug

 - 35

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR167a-3p

Accession MIMAT0037417
Sequence

70 - 

agaucaucuggcaguuucacc

 - 90

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).