Stem-loop sequence csi-MIR857

AccessionMI0016728 (change log)
DescriptionCitrus sinensis miR857 stem-loop
Literature search

3 open access papers mention csi-MIR857
(4 sentences)

Stem-loop
   uguugaaaauugauuaaaaaaaaguugaaaag    -      -  a       ug -       -   gagg     gaga     g  aa 
5'                                 ucaa auucaa ag caucauu  a auucaaa ugg    uggcc    acuuu aa  g
                                   |||| |||||| || |||||||  | ||||||| |||    |||||    ||||| ||   
3'                                 aguu uaaguu uc gugguaa  u uaaguuu auc    accgg    ugaag uu  u
   ------------------------------aa    g      a  g       gu g       u   -aaa     ----     g  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999178.1: 74122-74268 [-]
intergenic
JH999178.1: 312951-313097 [-]
intergenic
JH999178.1: 315019-315165 [-]
intergenic
Database links

Mature sequence csi-miR857

Accession MIMAT0018486
Sequence

112 - 

uuuugaauguugaaugguggcuau

 - 135

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).