![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR827 |
|||||
Accession | MI0016727 (change log) | ||||
Description | Citrus sinensis miR827 stem-loop | ||||
Gene family | MIPF0001113; MIR827_3 | ||||
Literature search |
4 open access papers mention csi-MIR827 | ||||
Stem-loop |
-------------------- c u --uu uuu uccu 5' g uuguugau gucaucuaaucau uc uuca a | |||||||| ||||||||||||| || |||| 3' c aacaacua caguagauuggua ag aagu g cguacguuaugguacuuaua a c uauu --u uuaa |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR827 |
|
Accession | MIMAT0018485 |
Sequence |
61 - uuagaugaccaucaacaaaca - 81 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
2 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|