Stem-loop sequence csi-MIR530a

AccessionMI0016724 (change log)
DescriptionCitrus sinensis miR530a stem-loop
Gene family MIPF0000521; MIR530
Literature search

1 open access papers mention csi-MIR530a
(6 sentences)

Stem-loop
   ---            u    c         g u     guua  u    --   c ag      c 
5'    auuuaucugcau ugca cugcaccuu c gugcu    uc gggu  uga g  gaucau a
      |||||||||||| |||| ||||||||| | |||||    || ||||  ||| |  ||||||  
3'    uaaguggacgua augu gacguggaa g uacga    ag cuca  acu c  cuagua u
   ccg            u    c         - -     ---a  -    aa   u ga      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr8: 18992462-18992582 [+]
intergenic
Database links

Mature sequence csi-miR530a-5p

Accession MIMAT0018482
Sequence

8 - 

ugcauuugcaccugcaccuug

 - 28

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR530a-3p

Accession MIMAT0037412
Sequence

93 - 

aggugcagcuguauaugcagg

 - 113

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).