Stem-loop sequence csi-MIR477b

AccessionMI0016719 (change log)
DescriptionCitrus sinensis miR477b stem-loop
Gene family MIPF0000216; MIR477
Literature search

1 open access papers mention csi-MIR477b
(3 sentences)

Stem-loop
   --------ca     aauc    u       -    c         -u u         auauaacg   auau    a 
5'           aaagc    gucg ucacucu cccu aagggcuuc  c ucgauccau        uac    gcuc a
             |||||    |||| ||||||| |||| |||||||||  | |||||||||        |||    ||||  
3'           uuucg    cagc agugaga ggga uucccgaag  g agcuaggua        gug    ugag a
   ccuuuuacuc     gccu    u       c    -         uc c         --------   ---g    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 9419304-9419441 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR477b
csi-MIR477bchr7: 9419304-9419441 [+]
csi-MIR477cchr7: 9419500-9419658 [+]
Database links

Mature sequence csi-miR477b-5p

Accession MIMAT0018476
Sequence

20 - 

cucucccucaagggcuucucu

 - 40

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR477b-3p

Accession MIMAT0037410
Sequence

93 - 

ugaagcccuuagggcagaguga

 - 114

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).