Stem-loop sequence csi-MIR477a

AccessionMI0016718 (change log)
DescriptionCitrus sinensis miR477a stem-loop
Gene family MIPF0000216; MIR477
Literature search

2 open access papers mention csi-MIR477a
(9 sentences)

Stem-loop
   ----------------a        ----      c a         gaa  c         -a        ccu   au 
5'                  aaauggag    aagcuu c accucccuc   gg uuccaauau  ccaugcuu   caa  u
                    ||||||||    |||||| | |||||||||   || |||||||||  ||||||||   |||  g
3'                  uuuaccuc    uucgaa g uggaggggg   cc aagguugua  gguacgaa   guu  g
   gugcaugucuugacuaa        agua      a c         auc  a         ag        --u   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 15360858-15360997 [-]
intergenic
Database links

Mature sequence csi-miR477a-5p

Accession MIMAT0018475
Sequence

19 - 

accucccucgaaggcuuccaa

 - 39

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR477a-3p

Accession MIMAT0037409
Sequence

84 - 

ggaaacccuagggggaggucg

 - 104

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).