Stem-loop sequence csi-MIR477c

AccessionMI0016717 (change log)
DescriptionCitrus sinensis miR477c stem-loop
Gene family MIPF0000216; MIR477
Literature search

1 open access papers mention csi-MIR477c
(3 sentences)

Stem-loop
   --------------------------------------ccaaagcaguaga    u      uc              c  -       aa    g  g 
5'                                                    gucg ucacuc  ccucaagggcuucg ca caaucca  ucau cu a
                                                      |||| ||||||  |||||||||||||| || |||||||  |||| ||  
3'                                                    cagc agugag  gggguuccugaagu gu guugggu  ggug ga a
   aucggaagcucaacagaagacgcuagcaguaaucgcucaauuuuuuguccg    u      uu              c  a       -g    -  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence csi-miR477c-5p

Accession MIMAT0018474
Sequence

21 - 

acucucccucaagggcuucgc

 - 41

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR477c-3p

Accession MIMAT0037408
Sequence

83 - 

gaaguccuugggguugaguga

 - 103

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).