Stem-loop sequence csi-MIR482f

AccessionMI0016716 (change log)
DescriptionCitrus sinensis miR482f stem-loop
Gene family MIPF0000403; MIR482
Literature search

4 open access papers mention csi-MIR482f
(6 sentences)

Stem-loop
   g           a      u a  -        u   aa       c 
5'  ggaagucuugg gauggg g gu ugggaaaa aau  cuuucuu a
    ||||||||||| |||||| | || |||||||| |||  ||||||| c
3'  cuuuuagaauc cuaccc c ca acccuuuu uua  gaaagaa g
   -           c      u -  c        u   ac       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 9962813-9962906 [+]
intergenic
Database links

Mature sequence csi-miR482f-5p

Accession MIMAT0037407
Sequence

14 - 

gaugggugaguugggaaaaua

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR482f-3p

Accession MIMAT0018473
Sequence

64 - 

uuuucccacaccucccauccc

 - 84

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).