Stem-loop sequence csi-MIR399b

AccessionMI0016713 (change log)
DescriptionCitrus sinensis miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention csi-MIR399b
(12 sentences)

Stem-loop
   gaagcagu    -  uu            uu                g  ggccaagggcaaagaucauauaauauauuuauau 
5'         aagc ga  uaguuguagggc  cucuccuuuggcaggu au                                  a
           |||| ||  ||||||||||||  |||||||||||||||| ||                                  u
3'         uucg cu  gucaauaucccg  gagaggaaaccgucca ua                                  a
   aauaaauu    a  uc            uu                g  acuuuuuuaucuuguuauuaaucuuauccguggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 7022847-7023016 [-]
intergenic
Database links

Mature sequence csi-miR399b-5p

Accession MIMAT0037404
Sequence

24 - 

agggcuucucuccuuuggcag

 - 44

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR399b-3p

Accession MIMAT0018470
Sequence

127 - 

ugccaaaggagaguugcccua

 - 147

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).