![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR399a |
||||||
Accession | MI0016712 (change log) | |||||
Description | Citrus sinensis miR399a stem-loop | |||||
Gene family | MIPF0000015; MIR399 | |||||
Literature search |
![]()
4 open access papers mention csi-MIR399a | |||||
Stem-loop |
cauugaggugcaugcaugcaguugcauauuaca c a cu u acauccaucu a 5' gggcaa aucucc uuggcagg gcauacu auu cauau u |||||| |||||| |||||||| ||||||| ||| ||||| 3' cccguu uagagg aaccgucu cguguga uga guaug a ----------uuuuauuuacgucuccuuaacgg - a uc c ----cuucuu c |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence csi-miR399a-5p |
|
Accession | MIMAT0037403 |
Sequence |
34 - gggcaacaucuccauuggcagg - 55 |
Evidence | experimental; Illumina [2] |
Mature sequence csi-miR399a-3p |
|
Accession | MIMAT0018469 |
Sequence |
114 - ugccaaaggagauuugcccgg - 134 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
2 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|