Stem-loop sequence csi-MIR396b

AccessionMI0016707 (change log)
DescriptionCitrus sinensis miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention csi-MIR396b
(1 sentences)

Stem-loop
   ----------ua   u   c                     c          u  ucuu   augag    ca 
5'             uga ccu uuuguauuuuuccacagcuuu uugaacugca ca    ugc     gcca  g
               ||| ||| ||||||||||||||||||||| |||||||||| ||    |||     ||||   
3'             acu gga aaacauagaagggugucgaaa aacuuggcgu gu    acg     cggu  a
   aacuuuaaaaua   u   c                     u          u  --uu   --gua    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr4: 3335321-3335454 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR396b
csi-MIR396bchr4: 3335321-3335454 [+]
csi-MIR396fchr4: 3340888-3341059 [-]
Database links

Mature sequence csi-miR396b-5p

Accession MIMAT0018464
Sequence

20 - 

uuccacagcuuucuugaacug

 - 40

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR396b-3p

Accession MIMAT0037399
Sequence

87 - 

guucaauaaagcugugggaag

 - 107

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).