![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR396a |
|||||
Accession | MI0016706 (change log) | ||||
Description | Citrus sinensis miR396a stem-loop | ||||
Gene family | MIPF0000047; MIR396 | ||||
Literature search |
1 open access papers mention csi-MIR396a | ||||
Stem-loop |
------------------------c --a u a c c c aauuuuccgaucgaua 5' ga gguccucuu gug u uuccacagcuuucuugaa ugu uug c || ||||||||| ||| | |||||||||||||||||| ||| ||| c 3' cu uuaggagaa cau a aaggugucgaaagaacuu aca aac g cuagagauaguuuucucucuaacua ggu u c a a c ccuuaauuaguacgug |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR396a-5p |
|
Accession | MIMAT0018463 |
Sequence |
21 - uuccacagcuuucuugaacug - 41 |
Evidence | experimental; Illumina [1-2] |
Mature sequence csi-miR396a-3p |
|
Accession | MIMAT0037398 |
Sequence |
89 - auucaagaaagcuguggaaaa - 109 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
2 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|