Stem-loop sequence csi-MIR394a

AccessionMI0016704 (change log)
DescriptionCitrus sinensis miR394a stem-loop
Gene family MIPF0000100; MIR394
Literature search

4 open access papers mention csi-MIR394a
(12 sentences)

Stem-loop
   -----cuu  u          -      u c             uccc   c  uu  aucu   a  - uuuuu uu 
5'         cu acagaguuua uuggca u uguccaccuccgu    cau ga  ga    gaa gc c     c  u
           || |||||||||| |||||| | |||||||||||||    ||| ||  ||    ||| || |     |  u
3'         gg ugucucgagu aaccgu a acggguggaggua    gua cu  cu    cuu cg g     g  c
   uucucuuc  u          c      c u             -cuc   -  uu  --cu   -  u uuuuu uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr3: 27992160-27992306 [+]
intergenic
Database links

Mature sequence csi-miR394a

Accession MIMAT0018461
Sequence

17 - 

uuggcauucuguccaccucc

 - 36

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).