Stem-loop sequence csi-MIR393a

AccessionMI0016703 (change log)
DescriptionCitrus sinensis miR393a stem-loop
Gene family MIPF0000083; MIR393
Literature search

2 open access papers mention csi-MIR393a
(9 sentences)

Stem-loop 
   ------------------------uucu  a  ua     ua      a      c      a      gccuua    uaauu 
5'                             gc ac  gagga  aaucca agggau gcauug uccuaa      auua     c
                               || ||  |||||  |||||| |||||| |||||| ||||||      ||||     c
3'                             cg ug  uuccu  uuaggu ucccua cguagc aggauu      uaau     c
   auacaucucuaauauauauauguauacu  a  gc     cc      c      u      -      -acuua    ucaua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 28763391-28763535 [-]
intergenic
Database links

Mature sequence csi-miR393a

Accession MIMAT0018460
Sequence

20 -  

auccaaagggaucgcauugauc

 - 41

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).