![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR393a |
|||||
Accession | MI0016703 (change log) | ||||
Description | Citrus sinensis miR393a stem-loop | ||||
Gene family | MIPF0000083; MIR393 | ||||
Literature search |
2 open access papers mention csi-MIR393a | ||||
Stem-loop |
------------------------uucu a ua ua a c a gccuua uaauu 5' gc ac gagga aaucca agggau gcauug uccuaa auua c || || ||||| |||||| |||||| |||||| |||||| |||| c 3' cg ug uuccu uuaggu ucccua cguagc aggauu uaau c auacaucucuaauauauauauguauacu a gc cc c u - -acuua ucaua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR393a |
|
Accession | MIMAT0018460 |
Sequence |
20 - auccaaagggaucgcauugauc - 41 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
2 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|