![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR159d |
|||||
Accession | MI0016702 (change log) | ||||
Description | Citrus sinensis miR159d stem-loop | ||||
Gene family | MIPF0001104; MIR319 | ||||
Literature search |
![]()
5 open access papers mention csi-MIR159d | ||||
Stem-loop |
ucgucucuuaauaaaauuugcgaaaau u a g c -------guu ua 5' gg agaa uagggguuccuu cgg ccaaaaca ggc a || |||| |||||||||||| ||| |||||||| ||| c 3' uc ucuu auccucgaggga guc gguuuugu ucg u -----------------------uuuc u a a a aucucucuuc uc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR159d |
|
Accession | MIMAT0018459 |
Sequence |
90 - uuuggacugaagggagcuccu - 110 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
2 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|