Stem-loop sequence csi-MIR159d

AccessionMI0016702 (change log)
DescriptionCitrus sinensis miR159d stem-loop
Gene family MIPF0001104; MIR319
Literature search

5 open access papers mention csi-MIR159d
(28 sentences)

Stem-loop 
   ucgucucuuaauaaaauuugcgaaaau  u    a            g   c        -------guu   ua 
5'                            gg agaa uagggguuccuu cgg ccaaaaca          ggc  a
                              || |||| |||||||||||| ||| ||||||||          |||  c
3'                            uc ucuu auccucgaggga guc gguuuugu          ucg  u
   -----------------------uuuc  u    a            a   a        aucucucuuc   uc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr4: 17295819-17295941 [+]
intergenic
Database links

Mature sequence csi-miR159d

Accession MIMAT0018459
Sequence

90 -  

uuuggacugaagggagcuccu

 - 110

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).