Stem-loop sequence csi-MIR159a

AccessionMI0016693 (change log)
DescriptionCitrus sinensis miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

5 open access papers mention csi-MIR159a
(28 sentences)

Stem-loop
   gg  ua  ga            ga             uucu   --     ua   u     g u   c    g uc      u     --g     gauu      u 
5'   gu  ag  guggagcuccuu  aguccaaaagagg    agc  aaggg  aau gagcu c gag uaug a  ccacag ccuau   uauca    uuaggg u
     ||  ||  ||||||||||||  |||||||||||||    |||  |||||  ||| ||||| | ||| |||| |  |||||| |||||   |||||    |||||| u
3'   ca  uc  caucucgaggga  uuagguuuuuucc    uug  uuccc  uua uucga g cuu auac u  gguguu ggaua   guggu    agucuu g
   --  uc  uc            ag             cauu   aa     ca   c     g u   u    g uc      u     gua     -agu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 31258923-31259134 [-]
intergenic
Database links

Mature sequence csi-miR159a-5p

Accession MIMAT0037392
Sequence

14 - 

gagcuccuugaaguccaaaag

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR159a-3p

Accession MIMAT0018450
Sequence

183 - 

uuuggauugaagggagcucua

 - 203

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).