Stem-loop sequence csi-MIR3946

AccessionMI0016692 (change log)
DescriptionCitrus sinensis miR3946 stem-loop
Literature search

2 open access papers mention csi-MIR3946
(17 sentences)

Stem-loop
   ---auaa   uga    gacaau a       a    a   gaa      a  aacuuuuugcugaaaguagcuuug 
5'        aga   ugau      g auuuugu gaga aga   gagagc ca                        a
          |||   ||||      | ||||||| |||| |||   |||||| ||                        u
3'        ucu   auug      c uaagaua uuuu ucu   cuuuug gu                        u
   cuaaaaa   -cg    -aaaau a       a    a   gaa      a  aauagauacuuggcuauguguagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr8: 625035-625186 [-]
intergenic
Database links

Mature sequence csi-miR3946

Accession MIMAT0018449
Sequence

26 - 

uuguagagaaagagaagagagcac

 - 49

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).