Stem-loop sequence ngi-mir-932

AccessionMI0016645 (change log)
DescriptionNasonia giraulti miR-932 stem-loop
Gene family MIPF0000588; mir-932
Stem-loop
   --    uu   u     a     ua    a      ua     aa 
5'   cgcg  gcc cuuca uuccg  gugc uugcag  gauuu  a
     ||||  ||| ||||| |||||  |||| ||||||  |||||  a
3'   gugc  cgg ggagu agggc  cacg aacguc  uuaga  g
   cu    uu   c     g     gc    -      --     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-932

Accession MIMAT0018404
Sequence

13 - 

ucaauuccguagugcauugcag

 - 34

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).