Stem-loop sequence ngi-mir-100

AccessionMI0016643 (change log)
DescriptionNasonia giraulti miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -ua     g   -c    c      cc  -  -   --g  uuu 
5'    cugau aca  uacc guagau  ga cu gug   gc   u
      ||||| |||  |||| ||||||  || || |||   ||    
3'    gacug ugu  augg caucua  cu ga cgc   cg   a
   ccg     a   ac    c      uc  c  a   aua  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-100

Accession MIMAT0018402
Sequence

13 - 

uacccguagauccgacuguggg

 - 34

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).