Stem-loop sequence ngi-mir-210

AccessionMI0016640 (change log)
DescriptionNasonia giraulti miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   u   --     g gc        gc   -         uuaga 
5'  gga  cccca u  agcugcug  cac ugcacaaga     c
    |||  ||||| |  ||||||||  ||| |||||||||     a
3'  ccu  ggggu g  ucggcgac  gug gcguguucu     u
   a   uc     g ua        -a   u         cagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-210

Accession MIMAT0018399
Sequence

51 - 

uugugcgugugacagcggcua

 - 71

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).