Stem-loop sequence ngi-mir-2

AccessionMI0016634 (change log)
DescriptionNasonia giraulti miR-2 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   ----------ca    uuuac              u  c    ggc 
5'             ugcu     caucaaagcugguu gu auag   u
               ||||     |||||||||||||| || ||||    
3'             acga     guaguuucgaccga ca uauc   u
   gccuguguuaaa    -----              -  c    agc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-2

Accession MIMAT0018393
Sequence

43 - 

uaucacagccagcuuugaugagc

 - 65

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).