Stem-loop sequence ngi-mir-219

AccessionMI0016632 (change log)
DescriptionNasonia giraulti miR-219 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   ugucu     ua    u    aa            ---   gug 
5'      cgggc  ugau gucc  acgcaauucuug   ucu   c
        |||||  |||| ||||  ||||||||||||   |||    
3'      gcucg  acua cagg  uguguuaagaac   aga   c
   -----     cg    -    gg            cau   guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-219

Accession MIMAT0018391
Sequence

13 - 

ugauuguccaaacgcaauucuug

 - 35

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).