![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3940 |
|||||
Accession | MI0016597 (change log) | ||||
Symbol | HGNC:MIR3940 | ||||
Description | Homo sapiens miR-3940 stem-loop | ||||
Gene family | MIPF0001599; mir-3940 | ||||
Literature search |
![]()
13 open access papers mention hsa-mir-3940 | ||||
Stem-loop |
gcuuauc -aaa ---- -- c au 5' gagga gaucgaggu ggguugggg cgggcu ugggg u ||||| ||||||||| ||||||||| |||||| ||||| 3' uuccu uugguucca cccgacccu gcccga acucu u -ucuucc cuca uuca ag c gg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3940-5p |
|
Accession | MIMAT0019229 |
Sequence |
23 - guggguuggggcgggcucug - 42 |
Deep sequencing | 49 reads, 26 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence hsa-miR-3940-3p |
|
Accession | MIMAT0018356 |
Previous IDs | hsa-miR-3940 |
Sequence |
57 - cagcccggaucccagcccacuu - 78 |
Deep sequencing | 450 reads, 97 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 | |
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|