Stem-loop sequence hsa-mir-3940

Accession

MI0016597 (change log)

Symbol

HGNC:MIR3940

Description

Homo sapiens miR-3940 stem-loop

Gene family

MIPF0001599; mir-3940

Literature search

13 open access papers mention hsa-mir-3940
(22 sentences)

Stem-loop

   gcuuauc     -aaa         ----         --      c     au 
5'        gagga    gaucgaggu    ggguugggg  cgggcu ugggg  u
          |||||    |||||||||    |||||||||  |||||| |||||   
3'        uuccu    uugguucca    cccgacccu  gcccga acucu  u
   -ucuucc     cuca         uuca         ag      c     gg 

Deep sequencing

518 reads, 0.952 reads per million, 105 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr19: 6416410-6416511 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000453308 ; KHSRP-005; exon 3

  OTTHUMT00000453305 ; KHSRP-001; exon 15

  ENST00000579148 ; MIR3940-201; exon 1

  ENST00000595223 ; KHSRP-005; exon 3

  ENST00000398148 ; KHSRP-001; exon 15

Database links

• EntrezGene:MIR3940
• HGNC:MIR3940
• RNAcentral:URS000075BFE0_9606
• miRBase Tracker:MI0016597

Mature sequence hsa-miR-3940-5p

• Accession: MIMAT0019229
• Sequence: 23 - guggguuggggcgggcucug - 42
• Deep sequencing: 49 reads, 26 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetMiner:hsa-miR-3940-5p
  • TargetScanVert:hsa-miR-3940-5p
  • miRDB:hsa-miR-3940-5p

Mature sequence hsa-miR-3940-3p

• Accession: MIMAT0018356
• Previous IDs: hsa-miR-3940
• Sequence: 57 - cagcccggaucccagcccacuu - 78
• Deep sequencing: 450 reads, 97 experiments
• Evidence: experimental; Illumina [1-2]
• Database links:
  • RNAcentral:URS000008B558_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3940-3p
  • TargetScanVert:hsa-miR-3940-3p
  • miRDB:hsa-miR-3940-3p

References

1. PMID:20498841 "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH PLoS One. 5:e10563(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).