Stem-loop sequence gma-MIR4400

AccessionMI0016557 (change log)
DescriptionGlycine max miR4400 stem-loop
Stem-loop
                                 a g     acuccgaaaaacuccuagaagaaccuucuuccggaagaa 
5' cggaagacucuucuuucggaaaaauucugg a acguc                                       g
   |||||||||||||||||||||||||||||| | |||||                                       a
3' gucuucugggaagaaagcuuuuuuaaggcc u ugcag                                       a
                                 c g     gaacgucuugcauaagaccucaagaagcccuccgggugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 1756046-1756202 [+]
intergenic
Database links

Mature sequence gma-miR4400

Accession MIMAT0018316
Sequence

15 - 

uucggaaaaauucuggaagacguc

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).