Stem-loop sequence gma-MIR4394

AccessionMI0016550 (change log)
DescriptionGlycine max miR4394 stem-loop
Stem-loop
   -uu   u                           aaaaaacaa  a 
5'    gcc ccuuucucuuugguccauuuuagugug         gg g
      ||| |||||||||||||||||||||||||||         || u
3'    cgg ggaaagagaaaucagguaaagucacac         cc c
   ggc   -                           ---auauac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 20498009-20498098 [-]
intergenic
Database links

Mature sequence gma-miR4394

Accession MIMAT0018309
Sequence

66 - 

aauggacuaaagagaaaggggccg

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).