Stem-loop sequence gma-MIR4381

AccessionMI0016529 (change log)
DescriptionGlycine max miR4381 stem-loop
Gene family MIPF0001257; MIR4372
Stem-loop
   -       a    g  a           ca u       aacauuauaugucacgauuuuauuagagg 
5'  cuuguca cguu ac gucacaugucg  c uuuauug                             u
    ||||||| |||| || |||||||||||  | |||||||                             u
3'  gaacagu gcaa ug caguguauagc  g aaauaac                             g
   u       g    a  g           ac u       cugcaacuaaaacaugugaauuaauuaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr15: 47293543-47293680 [-]
intergenic
Database links

Mature sequence gma-miR4381

Accession MIMAT0018288
Sequence

114 - 

uaugugacgguaaacggugacaag

 - 137

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).