Stem-loop sequence gma-MIR4377

AccessionMI0016522 (change log)
DescriptionGlycine max miR4377 stem-loop
Gene family MIPF0001141; MIR4371
Stem-loop
   uuua         a         a     ---gacgaac              uaaucacu     a   g     cg      a 
5'     ucuucuguu agugaugac uggca          cacguuauuauguu        gacac uca uauca  ucauug g
       ||||||||| ||||||||| |||||          ||||||||||||||        ||||| ||| |||||  ||||||  
3'     agaagguaa ucgcuacug aucgu          guguaguaguguag        cugug agu auagu  aguaau g
   -agc         g         c     auauauuaca              cacaauac     a   a     au      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 17757695-17757862 [+]
intergenic
Database links

Mature sequence gma-miR4377

Accession MIMAT0018281
Sequence

144 - 

uacgucaucgcugaauggaagacg

 - 167

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).